RegulonDB RegulonDB 10.8: Gene Sequence
brnQ gene sequence


Size: 1320        A: 208  T: 378  G: 377  C: 357

Fasta

 

>brnQ E. coli K12. Version NC_000913.3 GI:556503834
atgacccatcaattaagatcgcgcgatatcatcgctctgggctttatgacatttgcgttg
ttcgtcggcgcaggtaacattattttccctccaatggtcggcttacaggcaggcgaacac
gtctggactgcggcattcggcttcctcattactgccgttggcctgccggtattaacggta
gtggcgctggcaaaagttggcggcggtgttgacagcctcagcacgccaatcggtaaagtc
gctggcgtactgctggcaacggtttgttacctggcggtggggccgcttttcgctacgccg
cgtacagctaccgtttcctttgaagtggggattgcgccgctgacgggtgattccgcgctg
ccgctgtttatctacagcctggtctatttcgctatcgttattctggtttcgctctatccg
ggcaagctgctggataccgtgggcaacttccttgcgccgctgaaaattatcgcgctggtc
atcctgtctgttgccgctattgtctggccggcgggttctatcagcacggcgactgaggct
tatcaaaacgctgcgttttctaacggcttcgttaacggctatctgaccatggatacgctg
ggcgcaatggtgtttggtatcgttattgttaacgcggcgcgttctcgtggcgttaccgaa
gcgcgtctgctgacccgttataccgtctgggctggcctgatggcgggtgttggtctgact
ctgctgtacctggcgctgttccgtctggggtcagacagcgcgtcgctggtcgatcagtct
gcaaacggcgctgctattctgcatgcttacgttcagcacacctttggcggcggcggtagc
ttcctgctggcggcgttaatcttcatcgcctgcctggtaacggcagttggcctgacctgt
gcttgtgcagaattctttgcccagtacgtaccgctctcttatcgtacgctggtgtttatc
ctcggcggcttctcgatggtggtttctaacctcggcttaagccagctgatccagatctcc
gtaccggtgctgaccgctatttatccgccgtgtatcgcactggttgtattaagttttaca
cgctcatggtggcataattcgtcccgcgtgattgctccgccgatgtttatcagcctgctt
tttggtattctcgacgggatcaaagcatctgcattcagcgatatcttaccgtcctgggcg
cagcgtttaccgctggccgaacaaggtctggcgtggttaatgccaacagtggtgatggtg
gttctggccattatctgggatcgcgcggcaggtcgtcaggtgacctccagcgctcactaa
              
                            

Download fasta file
RegulonDB