RegulonDB RegulonDB 11.0: Gene Sequence
ccmD gene sequence


Size: 210        A: 32  T: 58  G: 70  C: 50

Fasta

 

>ccmD E. coli K12. Version NC_000913.3 GI:556503834
atgacccctgcatttgcttcctggaatgaatttttcgcaatgggcggttacgcctttttt
gtctggctggcggtggtgatgaccgttattccgctggtggttttggtcgtgcactcggtg
atgcaacatcgcgcaattctgcgtggcgtggcgcaacagcgggcgcgtgaggcgcgttta
cgtgctgcgcaacagcaggaggctgcatga
              
                            

Download fasta file
RegulonDB