RegulonDB RegulonDB 10.8: Gene Sequence
ampG gene sequence


Size: 1476        A: 257  T: 427  G: 411  C: 381

Fasta

 

>ampG E. coli K12. Version NC_000913.3 GI:556503834
atgtccagtcaatatttacgtatttttcaacagccgcgttcagccatattgctgatcctg
ggttttgcttccgggctaccgctcgccctgacatccggtaccttacaggcctggatgacg
gtcgagaatatcgatctcaaaaccattggtttcttctctctggtaggccaggcttacgtt
tttaaattcctctggtcaccgctgatggaccgctacacgcctccattttttgggcggcgg
cgcggttggctgctcgccacgcaaatcctgttattagtcgccattgcggcgatgggtttt
ctcgaaccaggcacccaactccgctggatggcggcgctggcagtggtgatcgctttttgc
tctgcttcccaggatatagtcttcgatgcgtggaaaaccgatgtgcttccggcagaagaa
cgtggtgcgggcgcggcaatcagcgtgctgggttaccgtttagggatgctggtttccggc
ggcctagccctgtggctggcagataaatggctgggctggcagggcatgtactggttaatg
gcggcactgttgatcccctgtattatcgcgacgttgcttgcaccagaaccaaccgacacc
attcctgtgcccaaaacgctggaacaagcggttgttgcacctctgcgagatttctttggt
cgcaataatgcctggcttattttgcttcttatcgtgctgtataagctgggcgacgcattc
gccatgagcctgacaaccacgtttttgattcgcggcgtcgggtttgatgcgggtgaagta
ggcgtggttaacaaaacgcttggcttactagcgaccattgttggcgcattgtacggtggg
attttgatgcagcgcctgtcactgttccgggcactgctgattttcggcattttacaaggt
gcgtctaacgccggttactggctgctgtcgattactgataagcatctctacagcatgggc
gcagccgtctttttcgaaaacctctgtggcgggatgggcacatcagcctttgtcgcgctg
ttaatgacgctatgtaataagtcattttccgctactcaatttgccctgctctcagcgctt
tctgctgtagggcgagtttatgtcggccccgtggcgggttggtttgttgaagcacacggc
tggtcgacattctatctattctccgtcgccgctgccgtaccagggcttattttgctgctg
gtttgccgccagacgcttgaatatacacgagtaaatgacaactttatctcccgtaccgca
tatccggcaggttatgcctttgccatgtggacactggcggcgggcgtcagcctgttggcc
gtgtggttactgctattgacgatggacgcgctggatttgacgcacttctctttcctgcct
gctctgctggaagtcggggttttagtcgccctttctggcgtcgtgcttggtggtttgctg
gattatctggcgctacgaaaaacgcatctgacgtaa
              
                            

Download fasta file
RegulonDB