RegulonDB RegulonDB 10.8: Gene Sequence
glnK gene sequence


Size: 339        A: 92  T: 75  G: 97  C: 75

Fasta

 

>glnK E. coli K12. Version NC_000913.3 GI:556503834
atgaagctggtgaccgtgataatcaaaccattcaagctggaagacgttcgtgaagcgtta
tcttccattggtattcagggcctgaccgtcaccgaagtgaaaggtttcgggcgtcagaaa
gggcatgccgagctgtaccggggggcggaatacagcgtcaatttcctgccaaaagtaaaa
attgatgtggcgattgctgatgaccaactcgatgaagtgatcgatatcgtcagtaaggcg
gcttacaccggaaaaattggcgacggcaaaatcttcgtcgctgaattgcaacgcgtcatt
cgtattcgtaccggcgaagccgacgaagcggcgctgtaa
              
                            

Download fasta file
RegulonDB