RegulonDB RegulonDB 10.8: Gene Sequence
nadK gene sequence


Size: 879        A: 229  T: 211  G: 210  C: 229

Fasta

 

>nadK E. coli K12. Version NC_000913.3 GI:556503834
atgaataatcatttcaagtgtattggcattgtgggacacccacggcaccccactgcactg
acaacacatgaaatgctctaccgctggctgtgcacaaaaggttacgaggtcatcgttgag
caacaaatcgctcacgaactgcaactgaagaatgtgaaaactggcacgctcgcggagatt
gggcaactagctgatctcgcggtagtcgttggtggcgacggtaatatgctgggcgcggca
cgcacactcgcccgttacgatattaaagttattggaatcaaccgtggcaacctgggtttc
ctgactgaccttgaccccgataacgcccagcaacagttagccgatgtgctggaaggccac
tacatcagcgagaaacgttttttgctggaagcgcaagtctgtcagcaagattgccagaaa
cgcatcagcaccgcgataaatgaagtggtgcttcatccaggcaaagtggcgcatatgatt
gagttcgaagtgtatatcgacgagatctttgcgttttctcagcgatctgatggactaatt
atttcgacgccaacaggctccaccgcctattccctctctgcaggcggtcctattctgacc
ccctctctggatgcgattaccctggtgcccatgttcccgcatacgttgtcagcacgacca
ctggtcataaacagcagcagcacgatccgtctgcgtttttcgcatcgccgtaacgacctg
gaaatcagttgcgacagccagatagcactgccgattcaggaaggtgaagatgtcctgatt
cgtcgctgtgattaccatctgaatctgattcatccgaaagattacagttatttcaacaca
ttaagcaccaagctcggctggtcaaaaaaattattctaa
              
                            

Download fasta file
RegulonDB