RegulonDB RegulonDB 10.9: Gene Sequence
cbpM gene sequence


Size: 306        A: 63  T: 77  G: 94  C: 72

Fasta

 

>cbpM E. coli K12. Version NC_000913.3 GI:556503834
atggctaatgttacggtgacttttactattaccgaattttgcctgcataccggcatctct
gaagaggagttgaatgaaattgtcggtttgggggtggttgaaccgcgtgagatccaggaa
acaacctgggtatttgacgaccatgccgccattgtggtgcaacgcgcggtacgcctgcgt
catgaactggctctggactggccggggatcgcggtggcgctgacgttaatggatgatatt
gcgcacctgaagcaggaaaaccgcctgctgcgccagcggctttcccggtttgtagctcat
ccgtga
              
                            

Download fasta file
RegulonDB