RegulonDB RegulonDB 10.10: Gene Sequence
pitA gene sequence


Size: 1500        A: 291  T: 398  G: 429  C: 382

Fasta

 

>pitA E. coli K12. Version NC_000913.3 GI:556503834
atgctacatttgtttgctggcctggatttgcataccgggctgttattattgcttgcactg
gcttttgtgctgttctacgaagccatcaatggtttccatgacacagccaacgccgtggca
accgttatctatacccgcgcgatgcgttctcagctcgccgtggttatggcggcggtattc
aactttttgggtgttttgctgggtggtctgagtgttgcctatgccattgtgcatatgctg
ccgacggatctgctgcttaatatgggatcgtctcatggccttgccatggtgttctctatg
ttgctggcggcgattatctggaacctgggtacctggtactttggtttacctgcatccagc
tctcatacgctgattggcgcgatcatcgggattggtttaaccaatgcgttgatgaccggg
acgtcagtggtggatgcactcaatatcccgaaagtattaagtattttcggttctctgatc
gtttcccctattgtcggcctggtgtttgctggcggtctgattttcttgctgcgtcgctac
tggagcggcaccaagaaacgcgcccgtatccacctgaccccagcggagcgtgaaaagaaa
gacggcaagaaaaagccgccgttctggacgcgtattgcgctgatcctttccgctatcggc
gtggcgttttcgcacggcgcgaacgatggtcagaaaggcattggtctggttatgttggta
ttgattggcgtcgcgccagcaggcttcgtggtgaacatgaatgccactggctacgaaatc
acccgtacccgtgatgccatcaacaacgtcgaagcttactttgagcagcatcctgcgctg
ctcaaacaggctaccggtgctgatcagttagtaccggctccggaagctggcgcaacgcaa
cctgcggagttccactgccatccgtcgaataccattaacgcgctcaaccgcctgaaaggt
atgttgaccaccgatgtggaaagctacgacaagctgtcgcttgatcaacgtagccagatg
cgccgcattatgctgtgcgtttctgacactatcgacaaagtggtgaagatgcctggcgtg
agtgctgacgatcagcgcctgttgaagaaactgaagtccgacatgcttagcaccatcgag
tatgcaccggtgtggatcatcatggcggtcgcgctggcgttaggtatcggtacgatgatt
ggctggcgccgtgtggcaacgactatcggtgagaaaatcggtaagaaaggcatgacctac
gctcaggggatgtctgcccagatgacggcggcagtgtctatcggcctggcgagttatacc
gggatgccggtttccactactcacgtactctcctcttctgtcgcggggacgatggtggta
gatggtggcggcttacagcgtaaaaccgtgaccagcattctgatggcctgggtgtttacc
cttccggctgcggtactgctttccggcgggctgtactggctctccttgcagttcctgtaa
              
                            

Download fasta file
RegulonDB