RegulonDB RegulonDB 10.10: Gene Sequence
uspB gene sequence


Size: 336        A: 67  T: 111  G: 86  C: 72

Fasta

 

>uspB E. coli K12. Version NC_000913.3 GI:556503834
atgataagcaccgtcgcattattttgggctttatgtgtcgtttgcattgttaacatggcg
cgctatttctcatcactacgcgcgttgttagtggtactgcgtaactgcgatccattgctc
tatcaatatgttgatggagggggcttttttacctcacatggccaacccaacaaacaggtg
cgtctcgtttggtatatctatgcccaacgttatcgcgatcatcacgatgatgaatttatt
cgccgctgtgagcgggtgcgtcggcagtttattctgaccagcgcattgtgtggtctggtg
gtggtcagcctgattgcattgatgatttggcattaa
              
                            

Download fasta file
RegulonDB