RegulonDB RegulonDB 10.10: Gene Sequence
mdtE gene sequence


Size: 1158        A: 295  T: 231  G: 309  C: 323

Fasta

 

>mdtE E. coli K12. Version NC_000913.3 GI:556503834
atgaacagaagaagaaagctgttaataccgttgttattctgcggcgcgatgctcaccgcc
tgcgatgacaaatcggcggaaaacgccgccgccatgacgcctgaggtcggtgtcgtcaca
ctctcccccggttcggtcaatgtgttgagcgaattgcccggtagaaccgttccttatgaa
gttgccgagatacgtccccaggtgggcggtattatcattaaacgcaactttatcgaaggc
gataaagtgaaccagggcgattcgctgtatcagattgatcctgcacctttacaggccgag
ctaaactccgccaaaggctcgctggcgaaagcgctctctaccgccagcaatgcccgcatc
acctttaaccgccaggcatcgttgctgaagaccaactacgttagccgtcaggattacgac
accgcgcgcacccagttgaatgaagcagaagccaatgtcaccgtcgccaaagcggctgtt
gaacaggcgacgatcaatctgcaatacgcgaatgtcacctcgccgattacgggcgtcagc
gggaaatcgtcggtgaccgtcggcgcactcgttaccgctaatcaggcagattcgctggtt
accgtacaacgtctggacccgatttatgtcgatctcacgcagtcggtgcaagatttctta
cgcatgaaagaagaggtcgccagtgggcaaatcaaacaggttcagggcagtacgccagta
cagctcaatctggaaaatggtaaacgctacagccagaccggcacgctgaaattctccgac
ccgacagtggatgaaaccacgggctccgtgacgttacgggcgattttccccaacccaaat
ggtgacttgctgcctggcatgtacgtcacggcattagtggatgaaggtagccgccagaat
gtattactggtgccgcaggaaggcgtcacccacaacgcccagggtaaagcaacggcgctc
attctggataaagacgatgtcgtgcagctacgcgaaattgaagccagcaaagccatcggc
gaccagtgggtcgtcacctctggcttgcaggctggcgatcgggtgatcgtttccggtttg
caacgcattcgtccgggtatcaaagcacgagcaatttcctccagccaggaaaacgccagc
accgaatcgaaacaataa
              
                            

Download fasta file
RegulonDB