RegulonDB RegulonDB 10.7: Gene Sequence
mdtF gene sequence


Size: 3114        A: 703  T: 760  G: 839  C: 812

Fasta

 

>mdtF E. coli K12. Version NC_000913.3 GI:556503834
atggctaactattttattgatcgcccggtttttgcctgggtacttgccattattatgatg
cttgcaggtggtctggcgatcatgaacttaccggttgcgcagtatccgcagattgcgcca
ccgaccattaccgtcagcgctacctatccaggtgccgatgcgcaaacggtagaagactcg
gtcactcaggtgattgagcaaaatatgaatgggcttgatggcctgatgtacatgtcttca
accagtgatgcggcgggcaatgcctctatcactctgaccttcgagactgggacatctcct
gatatcgcacaggttcaagtgcaaaataaactgcaactcgctatgccttcattacctgaa
gcagtgcagcagcaggggattagcgtcgataagtcgagcagtaatatcctgatggtagcg
gcgtttatttctgataacggcagcctcaaccagtacgatatcgcggactatgtagcgtct
aatatcaaagacccgctaagccgtaccgcgggcgttggtagcgtacaactctttggttcc
gagtatgccatgcgtatctggctggacccgcaaaaactcaataaatataacctggtacct
tccgatgttatttcccagattaaggtgcaaaacaaccagatttccggtggtcaactgggt
ggcatgccacaggcggcagaccagcagctaaacgcctcgatcattgtgcagacgcgtctg
caaacgccggaagaatttggcaaaatcctgttgaaagttcagcaagatggttcgcaagtg
ctgctgcgtgatgtcgctcgcgtcgaacttggggcggaagattattccaccgtggcacgc
tataacggcaaacctgctgccgggatcgccatcaaactggctgccggagcaaacgccctg
gatacctcgcgggcagtcaaagaggaactgaaccgcttatcagcctatttcccggcaagt
ctgaagacggtttatccttacgacaccacgccgtttatcgaaatttctattcaggaagtt
ttcaaaacactggttgaggctatcatcctagtcttcctggtcatgtatctgtttttgcag
aatttccgtgccacaatcatcccgacgattgccgtaccggtggttattctcgggacgttt
gcgatcttgtcggcggtcggtttcaccatcaacacgttgactatgttcgggatggtgctg
gcgatagggttactggtggatgacgccatcgtggtggtggagaacgtcgagcgtgtcatt
gcggaagataagctaccgccgaaggaagcgacgcataaatcgatggggcagatccaacgt
gcgctggtcggtattgccgttgttctttccgcagtgtttatgccgatggcctttatgagc
ggtgcaaccggggagatctaccgccagttctccatcacgctgatctcctccatgctgctt
tcagtatttgtggcaatgagcctgacccctgccctgtgcgccaccattctgaaagccgcg
ccggaaggcggtcacaaacctaacgccctgttcgcacgcttcaacacgctgtttgaaaaa
tcaactcaacactataccgatagcacccgctcgctgttgcgttgtaccggtcgctacatg
gtggtctacctgctgatttgcgccgggatggcggtgctgttcctgcgcacgccgacctct
ttcttaccagaagaggatcagggggtatttatgaccaccgcgcagttaccttccggtgcc
accatggttaacaccacgaaagtgctgcaacaggtgacggattattatctgactaaagag
aaagataatgtccagtcggtgtttaccgttggcggctttggcttcagcggtcaggggcaa
aacaacggcctggcgtttatcagtctcaagccgtggtctgaacgtgtcggtgaggaaaac
tcggttaccgcgatcattcagcgggcaatgattgcgttaagcagtatcaataaagccgtc
gtcttcccgttcaacttacccgcggtggctgaactgggtaccgcgtcaggttttgatatg
gaactgctggacaacggtaacctggggcacgaaaaactaacccaggcgcgaaacgagctg
ttatcactggcagcgcaatcaccgaatcaggtcaccggggtacgcccgaacggcctggaa
gatacgccgatgttcaaagtgaacgtcaacgctgcgaaagctgaagcgatgggcgtggcg
ctgtctgatatcaaccagacaatttccaccgccttcggcagcagctacgtgaacgacttc
ctcaaccaggggcgggtgaaaaaagtgtatgtccaggcaggcacgccgttccgtatgttg
ccggataacatcaaccaatggtatgtacgcaacgcctctggcacgatggcaccgctttct
gcctactcgtctaccgaatggacctatggttcaccgcgactggaacgctacaacggcatc
ccgtcaatggagattttaggtgaagcggcggccgggaaaagtaccggtgacgccatgaaa
tttatggcagacctggtcgctaaacttccggcaggcgtcggctactcatggaccggacta
tcgtatcaggaagcgttatcctcaaatcaggctcctgcgctgtatgcgatttcactggtc
gtggtgttcctcgccctcgccgcactctatgagagctggtcaattccgttctcggtgatg
ttggttgttccgttaggcgtcgttggcgcattactggccaccgatctgcgcggcttaagt
aatgacgtctacttccaggttggtttgctgaccaccatcgggctttccgccaaaaacgcc
atcctgattgtcgaatttgccgttgagatgatgcagaaagaagggaaaacgccgatagag
gcaatcatcgaagcggcgcggatgcgtttacgcccaatcctgatgacctctctggccttt
attctcggcgtgctgccgctggttatcagtcatggtgccggttctggcgcgcaaaacgcg
gtaggtaccggcgtgatgggcgggatgtttgccgcaacagtgctggcaatttacttcgtt
ccggtctttttcgttgtagtggaacatctctttgcccgctttaaaaaagcgtaa
              
                            

Download fasta file
RegulonDB