RegulonDB RegulonDB 10.10: Gene Sequence
xylH gene sequence


Size: 1182        A: 229  T: 316  G: 329  C: 308

Fasta

 

>xylH E. coli K12. Version NC_000913.3 GI:556503834
atgtcgaaaagcaatccgtctgaagtgaaattggccgtaccgacatccggtggcttctcc
gggctgaaatcactgaatttgcaggtcttcgtgatgattgcagctatcatcgcaatcatg
ctgttctttacctggaccaccgatggtgcctacttaagcgcccgtaacgtctccaacctg
ttacgccagaccgcgattaccggcatcctcgcggtaggaatggtgttcgtcataatttct
gctgaaatcgacctttccgtcggctcaatgatggggctgttaggtggcgtcgcggcgatt
tgtgacgtctggttaggctggcctttgccacttaccatcattgtgacgctggttctggga
ctgcttctcggtgcctggaacggatggtgggtcgcgtaccgtaaagtcccttcatttatt
gtcaccctcgcgggcatgttggcatttcgcggcatactcattggcatcaccaacggcacg
actgtatcccccaccagcgccgcgatgtcacaaattgggcaaagctatctccccgccagt
accggcttcatcattggcgcgcttggcttaatggcttttgttggttggcaatggcgcgga
agaatgcgccgtcaggctttgggtttacagtctccggcctctaccgcagtagtcggtcgc
caggctttaaccgctatcatcgtattaggcgcaatctggctgttgaatgattaccgtggc
gttcccactcctgttctgctgctgacgttgctgttactcggcggaatgtttatggcaacg
cggacggcatttggacgacgcatttatgccatcggcggcaatctggaagcagcacgtctc
tccgggattaacgttgaacgcaccaaacttgccgtgttcgcgattaacggattaatggta
gccatcgccggattaatccttagttctcgacttggcgctggttcaccttctgcgggaaat
atcgccgaactggacgcaattgcagcatgcgtgattggcggcaccagcctggctggcggt
gtgggaagcgttgccggagcagtaatgggggcatttatcatggcttcactggataacggc
atgagtatgatggatgtaccgaccttctggcagtatatcgttaaaggtgcgattctgttg
ctggcagtatggatggactccgcaaccaaacgccgttcttga
              
                            

Download fasta file
RegulonDB