RegulonDB RegulonDB 10.9: Gene Sequence
sgbH gene sequence


Size: 663        A: 142  T: 127  G: 210  C: 184

Fasta

 

>sgbH E. coli K12. Version NC_000913.3 GI:556503834
atgagccgaccacttctgcaactggccctcgaccactcatcacttgaagccgcgcagcgc
gacgtgacgctgttaaaagacagcgtcgatatcgtcgaagcgggcaccattctctgttta
aacgaagggcttggcgcggtgaaagccttgcgcgaacagtgcccggacaaaatcatcgtt
gctgactggaaggtcgccgacgctggtgaaacgctcgcgcaacaggcgtttggcgcaggc
gctaactggatgaccatcatctgcgccgcgccgctcgcgacggtagaaaaaggccacgca
atggcacaacgctgcgggggtgaaattcagatagagctgttcggtaactggacgctggac
gacgcccgcgactggcatcgtattggcgtgcggcaggccatttatcatcgcggtcgtgat
gcacaggccagcgggcaacagtggggcgaagccgatctggcacgcatgaaggcgctttca
gatatcggccttgagctttccattactggcgggattacccctgctgacctgccgctgttt
aaagatatccgcgtgaaagcgtttattgccgggcgggcactggcaggcgcggcaaatccg
gcgcaagtggctggcgatttccatgcgcaaatcgacgctatctggggaggtgcgcgtgcg
taa
              
                            

Download fasta file
RegulonDB