RegulonDB RegulonDB 10.9: Gene Sequence
sgbE gene sequence


Size: 696        A: 163  T: 134  G: 199  C: 200

Fasta

 

>sgbE E. coli K12. Version NC_000913.3 GI:556503834
atgttagagcaactgaaagccgacgtgctggcggcgaatctggcgcttcccgctcaccat
ctggtgacgttcacctggggcaatgtcagcgcggtagacgaaacgcggcaatggatggta
atcaaaccttccggcgtcgagtacgacgtgatgaccgccgacgatatggtggtggttgag
atagccagcggtaaggtggtggaaggcagcaaaaaaccctcttccgatacaccaacgcat
ctggcgctctaccgtcgctatgccgaaattggcggtattgtgcatacccactcgcgccac
gccaccatctggtcacaggccgggctggatctccccgcctggggcaccacccacgccgat
tatttttacggtgccatcccctgcacgcgacagatgaccgcagaggagattaacggcgaa
tatgaatatcagaccggcgaagtgatcattgaaaccttcgaagaacgtggcaggagtccg
gcacaaatcccggcggtgctggtgcattctcacggcccgttcgcatggggtaaaaacgcc
gccgatgccgtgcataacgccgtagtactcgaagaatgcgcctatatgggtctattctcg
cgccagcttgcgccgcagctccctgcgatgcaaaacgaactgctggataagcactacctg
cgtaagcatggggccaatgcctattacgggcagtaa
              
                            

Download fasta file
RegulonDB