RegulonDB RegulonDB 10.9: Gene Sequence
yiaT gene sequence


Size: 741        A: 178  T: 202  G: 205  C: 156

Fasta

 

>yiaT E. coli K12. Version NC_000913.3 GI:556503834
atgttaattaatcgcaatattgtggcgttatttgcgttgccttttatggcaagcgcaact
gcttctgaattatccattggtgctggtgcggcttataatgaatcgccttatcgcggttat
aatgaaaatacgaaggcaattccgctgattagttatgaaggtgatactttttatgttcgt
cagaccacgttaggttttattctgtcgcaaagtgaaaaaaatgaacttagcctgaccgca
tcctggatgccgctggaatttgaccctaccgataatgacgattatgccatgcaacagctt
gataagcgtgatagtacggctatggcgggggttgcctggtatcaccacgagcgttgggga
accgtgaaagcctctgcagctgcggacgttctggataacagcaacggctgggtgggggag
ctatcggtattccacaaaatgcagataggtcgtctgtcgctgacacctgcgctgggcgtt
ctctattatgacgagaatttcagtgactattactatggcatttcagagagtgagtcccgt
cgtagcggtctggcaagttattccgcgcaggatgcctgggtgccctatgtcagcctgacg
gcaaaatacccgataggagagcacgtcgtattgatggcgagcgcaggatacagcgagctg
ccggaagagattaccgacagcccgatgattgatcgtaatgagagttttacctttgtcacc
ggggtgagctggcgtttttaa
              
                            

Download fasta file
RegulonDB