RegulonDB RegulonDB 10.10: Gene Sequence
tmk gene sequence


Size: 642        A: 151  T: 144  G: 184  C: 163

Fasta

 

>tmk E. coli K12. Version NC_000913.3 GI:556503834
atgcgcagtaagtatatcgtcattgaggggctggaaggcgcaggcaaaactaccgcgcgt
aatgtggtggttgagacgctcgagcaactgggtatccgcgacatggttttcactcgggaa
cctggcggtacgcaacttgccgaaaagttaagaagcctggtgctggatatcaaatcggta
ggcgatgaagtcattaccgataaagccgaagttctgatgttttatgccgcgcgcgttcaa
ctggtagaaacggtcatcaaaccagctctggctaacggcacctgggtgattggcgatcgc
cacgatctctccactcaggcgtatcagggcggcggacgtggtattgaccaacatatgctg
gcaacactgcgtgatgctgttctcggggattttcgccccgacttaacgctctatctcgat
gttaccccggaagttggcttaaaacgcgcgcgtgcgcgcggcgagctggatcgtattgag
caagaatctttcgatttctttaatcgcacccgcgcccgctatctggaactggcagcacaa
gataaaagcattcataccattgatgccacccagccgctggaggccgtgatggatgcaatc
cgcactaccgtgacccactgggtgaaggagttggacgcatga
              
                            

Download fasta file
RegulonDB