RegulonDB RegulonDB 10.8: Gene Sequence
yfhH gene sequence


Size: 849        A: 211  T: 199  G: 228  C: 211

Fasta

 

>yfhH E. coli K12. Version NC_000913.3 GI:556503834
atgaacggcttacttcgtatccgtcagcgttaccaggggcttgcccagagtgataaaaaa
ctggcggattatctgctgctacaacctgatacggcgcgccatttaagctctcagcaactg
gccaacgaagccggagtcagtcagtccagcgtcgtgaagttcgcgcaaaaactcggctat
aaaggttttccggcgcttaagttggcgttgagtgaagcgctggcaagccagccggaatca
ccctccgtgcccattcataaccaaatccgcggtgatgatccgttacggctggtcggcgaa
aaactgattaaagaaaatactgccgctatgtacgcaacgctaaacgttaatagtgaagag
aaactgcatgaatgcgtaacaatgttgcgctctgcgcggcggataattctgaccggtatt
ggcgcttcgggtctggtggcgcaaaactttgcctggaagctgatgaagattggcttcaat
gctgccgcagtgcgcgatatgcatgcgctactcgcaacagtacaggcgtcgtcccctgac
gatctgttattagccatttcctacaccggtgtacgacgcgagttaaacctggcggcagat
gagatgctgcgagtgggcggaaaagtgctggcgattaccggctttactccgaatgccctg
caacagcgtgcttctcattgcctgtataccattgccgaagaacaagcgacaaacagtgct
tcaatctctgcttgtcacgctcagggaatgttaacggatttgctgttcattgcgctgatt
cagcaggatctggaactggcaccagaacgtattcgtcatagtgaagcgctggtgaaaaaa
ctggtctga
              
                            

Download fasta file
RegulonDB