RegulonDB RegulonDB 11.0: Gene Sequence
yacH gene sequence


Size: 1854        A: 504  T: 351  G: 461  C: 538

Fasta

 

>yacH E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatgactttgccgtttaaaccccatgtgctggcgctaatttgcagtgccgggctt
tgtgccgcctctaccgggctatatataaaaagccgcacagtggaagcgcctgtggaaccg
caatcgacacaactggctgtgtctgacgctgccgcggttacgtttcctgcaacggtttcc
gcacctcccgtaacacccgccgtcgtcaaatccgcattcagcactgcacaaatagatcaa
tgggtcgcgcccgtcgcgctgtatcccgacgccctactttcgcaggtgctgatggcatca
acctatccgacaaacgttgctcaagcagtgcaatggtcgcacgataatccacttaaacaa
ggcgatgctgctattcaggcggtatctgaccagccgtgggacgccagcgttaaatcactg
gtggcctttccacaattgatggcattgatgggcgaaaacccgcaatgggtgcaaaacctg
ggcgatgcttttctggcccagccgcaggacgtgatggactcggtacagcgattgcggcaa
ctggcgcaacaaaccggctcgctgaagtcatcaaccgaacagaaagttattaccacaacg
aagaaagctgtaccggtaaaacagacagtcacggcacccgtcataccatccaatacagtt
ttaactgccaaccccgtcattacagagccggcaacaaccgtcatttccattgagcccgcc
aatcctgatgtggtctatattcccaactacaacccaaccgtggtttacgggaactgggcc
aatactgcgtatccgccggtttatctgccaccaccagccggagaaccgtttgttgacagc
tttgtacgcggattcggctatagcatgggcgttgctaccacgtacgcactattcagcagc
atcgactgggacgacgacgatcatgaccatcatcatcatgacaatgatgattatcatcac
cacgatggcggtcatcgtgacggtaatggctggcaacacaacggcgacaacatcaatatc
gacgtcaacaatttcaaccgtatcaccggtgagcatcttactgataagaatatggcatgg
cggcacaatccaaactaccgtaatggtgtgccctatcatgatcaggatatggcaaagcgg
tttcatcaaaccgatgtcaacggcggaatgagcgccacgcaattacctgccccaacgcgc
gacagccagcgtcaggcggcagcaaatcagtttcagcaacgaacacacgccgcaccagtc
attacacgagatacccaacgtcaggcagcggcacagcggtttaatgaagctgaacactat
gggagctatgacgacttccacgacttcagccgtcgccaaccactgacccagcaacaaaag
gacgccgctcgtcagcgttatcagtccgcctcgcctgagcagcgccaggcagttcgcgag
agaatgcagactaacccgaagatccagcagcgaagagaggcagcgcgtgagcgcattcag
tccgcctcgcctgagcagcgccaggcggttcgcgagaaaatgcagactaacccgcagaac
cagcagcgaagagacgcagcgcgtgagcgtattcagtccgcatcaccagagcagcgccag
gtgtttaaggaaaaagtacagcagcgcccactgaatcaacagcaacgtgataacgcccgc
cagcgtgttcaatcggcatcacctgaacaacgtcaggtttttcgggagaaagttcaggag
agccgcccacaacgtctaaacgacagtaaccatactgtcaggctgaataacgagcaacgg
tcagcagtatgcgaacgtctctctgaacgtggagcaagaagactggaaaggtaa
              
                            

Download fasta file
RegulonDB