RegulonDB RegulonDB 10.8: Gene Sequence
cueO gene sequence


Size: 1551        A: 357  T: 346  G: 472  C: 376

Fasta

 

>cueO E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgtcgtgatttcttaaaatattccgtcgcgctgggtgtggcttcggctttgccg
ctgtggagccgcgcagtatttgcggcagaacgcccaacgttaccgatccctgatttgctc
acgaccgatgcccgtaatcgcattcagttaactattggcgcaggccagtccacctttggc
gggaaaactgcaactacctggggctataacggcaatctgctggggccggcggtgaaatta
cagcgcggcaaagcggtaacggttgatatctacaaccaactgacggaagagacaacgttg
cactggcacgggctggaagtaccgggtgaagtcgacggcggcccgcagggaattattccg
ccaggtggcaagcgctcggtgacgttgaacgttgatcaacctgccgctacctgctggttc
catccgcatcagcacggcaaaaccgggcgacaggtggcgatggggctggctgggctggtg
gtgattgaagatgacgagatcctgaaattaatgctgccaaaacagtggggtatcgatgat
gttccggtgatcgttcaggataagaaatttagcgccgacgggcagattgattatcaactg
gatgtgatgaccgccgccgtgggctggtttggcgatacgttgctgaccaacggtgcaatc
tacccgcaacacgctgccccgcgtggttggctgcgcctgcgtttgctcaatggctgtaat
gcccgttcgctcaatttcgccaccagcgacaatcgcccgctgtatgtgattgccagcgac
ggtggtctgctacctgaaccagtgaaggtgagcgaactgccggtgctgatgggcgagcgt
tttgaagtgctggtggaggttaacgataacaaaccctttgacctggtgacgctgccggtc
agccagatggggatggcgattgcgccgtttgataagcctcatccggtaatgcggattcag
ccgattgctattagtgcctccggtgctttgccagacacattaagtagcctgcctgcgtta
ccttcgctggaagggctgacggtacgcaagctgcaactctctatggacccgatgctcgat
atgatggggatgcagatgctaatggagaaatatggcgatcaggcgatggccgggatggat
cacagccagatgatgggccatatggggcacggcaatatgaatcatatgaaccacggcggg
aagttcgatttccaccatgccaacaaaatcaacggtcaggcgtttgatatgaacaagccg
atgtttgcggcggcgaaagggcaatacgaacgttgggttatctctggcgtgggcgacatg
atgctgcatccgttccatatccacggcacgcagttccgtatcttgtcagaaaatggcaaa
ccgccagcggctcatcgcgcgggctggaaagataccgttaaggtagaaggtaatgtcagc
gaagtgctggtgaagtttaatcacgatgcaccgaaagaacatgcttatatggcgcactgc
catctgctggagcatgaagatacggggatgatgttagggtttacggtataa
              
                            

Download fasta file
RegulonDB