RegulonDB RegulonDB 10.8: Gene Sequence
fadK gene sequence


Size: 1701        A: 416  T: 437  G: 442  C: 406

Fasta

 

>fadK E. coli K12. Version NC_000913.3 GI:556503834
atgcatcccacaggcccgcatctcgggcctgatgttctgtttcgagagtccaacatgaaa
gtgacattaacgtttaacgaacaacgtcgtgcggcgtatcgtcagcaagggttatggggc
gatgcttcgctggccgattactggcagcagaccgctcgtgcgatgccagacaaaattgcc
gtggtcgataatcatggtgcatcgtacacctatagcgcgctcgatcacgccgcgagctgt
ctggcaaactggatgttagcgaagggtattgaatcaggcgatcgcatcgcatttcaactg
cctggctggtgtgaatttaccgttatctatcttgcctgcctgaaaatcggtgcagtttcc
gtgccgctgttgccttcctggcgggaagcagaactggtgtgggtgctcaataagtgtcag
gcaaaaatgttctttgcaccgacgttgtttaaacaaacgcgtccggtagatttaatcctg
ccgctgcaaaatcagcttccacaactacaacaaattgtcggcgtggacaaactggctccc
gccacctcttccctctcattaagtcagattatcgccgacaatacctcactgaccacggcg
ataacgacccacggcgatgaattagctgcggtgctgtttacctccggaaccgagggtctg
ccaaagggcgtgatgctaacgcataacaatattctcgccagtgagcgggcttattgcgcg
cgactgaatctgacctggcaggatgtctttatgatgcctgcgccacttggtcacgcaacg
ggctttctgcatggcgtaacggcaccattcttaattggcgctcgcagcgtgttgttagat
attttcactcctgatgcgtgtctcgcgctgcttgagcagcagcgttgcacctgtatgctc
ggcgcaacgccgtttgtctatgatcttttgaatgtactagagaaacaacccgcggacctt
tcagcgctgcgtttctttctttgcggcggaaccacaatccccaaaaaagtggcgcgtgaa
tgccagcagcgcggcattaaattattaagtgtttatggttccacagaaagttcgccgcat
gcggtggtgaatctcgatgatcctttgtcgcgctttatgcacaccgatggttacgctgcc
gcaggtgtagagattaaagtggtcgatgacgcacgcaagaccttaccgccaggttgcgaa
ggtgaagaagcctcgcgtggccccaatgtgtttatggggtattttgatgaacctgaatta
accgcccgtgccctggatgaagaaggctggtattacagcggcgatctctgccgtatggat
gaggctggctatataaaaattaccggacgcaaaaaagatattattgtccgcggcggcgaa
aatattagcagccgtgaagtggaagatattttattgcagcatcctaaaattcacgatgcc
tgtgtggttgcaatgtccgatgaacgtttaggtgaacgatcatgcgcttatgtcgtgctg
aaagcgccgcatcattcattatcgctggaagaggtagtggctttttttagccgtaaacgg
gtcgcaaaatataaatatcctgaacatatcgtggtaatcgaaaaactaccgcgaactacc
tcaggtaaaatacaaaagtttttgttaagaaaagatattatgcggcgtttaacgcaggat
gtctgtgaagagattgaataa
              
                            

Download fasta file
RegulonDB