RegulonDB RegulonDB 10.8: Gene Sequence
ssuB gene sequence


Size: 768        A: 172  T: 169  G: 258  C: 169

Fasta

 

>ssuB E. coli K12. Version NC_000913.3 GI:556503834
atgaatactgctcgtctgaaccagggcacgccattgttgctcaatgcagtaagcaaacat
tacgcggaaaatatcgtcctgaaccaactggatttacatattccggcaggtcagtttgtg
gcggtggtgggccgcagcggtggtggcaaaagtaccctgctgcgcctgctggcaggtctg
gaaacgccaaccgcaggcgatgtgttagcgggcaccacaccgctggctgaaattcaggaa
gacacgcgaatgatgtttcaggatgcgcgtctgctaccgtggaaatcggtgattgataac
gttgggttaggccttaaaggccagtggcgcgatgccgcacgtcgagcgttggctgcggta
ggactggagaatcgcgcaggggaatggcctgccgcactttctggcgggcagaaacagcga
gtggcgctggcaagagcgttgattcatcgaccgggattattgttgcttgatgaaccgctc
ggggcgctggacgccttaacgcgactcgagatgcaggatttgattgtgtcactttggcag
gagcacggctttaccgtactgttggtgacgcatgatgtgagcgaagcggtagcgatggct
gaccgggtgctgttaattgaagagggaaaaattggtctggatttgacagtggatatcccc
cgtccgcgtcgattagggtcggtgcgattagcggagctggaagcggaggtgttgcaacgg
gtgatgcaacgtggtgaatctgaaactcgcctgagaaaacaggggtaa
              
                            

Download fasta file
RegulonDB