RegulonDB RegulonDB 10.9: Gene Sequence
nlpI gene sequence


Size: 885        A: 234  T: 224  G: 228  C: 199

Fasta

 

>nlpI E. coli K12. Version NC_000913.3 GI:556503834
atgaagccttttttgcgctggtgtttcgttgcgacagcacttacgcttgcaggatgcagt
aatacttcctggcgtaaaagtgaagtcctcgcggtaccattgcaaccgactttacagcag
gaagtgattctggcacgtatggaacaaatccttgccagtcgggctttaaccgatgacgaa
cgcgcacagcttttatatgagcgcggagtgttgtatgatagtctcggtctgagggcatta
gcgcgtaacgatttttcgcaagcgctggcaatccgaccggatatgcctgaagtattcaat
tacttaggcatatatttaacgcaggcaggcaattttgatgctgcctatgaagcgtttgat
tctgtacttgagcttgatccaacttacaactacgcgcacttgaatcgcgggatcgcatta
tattacggcggtcgtgacaagttagcgcaagatgatctgctggcgttttatcaagacgat
cccaatgatcctttccgtagtctgtggctttatctcgccgagcagaagctcgatgagaag
caggctaaagaagtgttgaaacagcacttcgaaaaatcggataaggaacagtggggatgg
aacattgtcgagttctacctgggcaacattagcgaacaaacgttaatggaaaggctcaag
gcggacgcaacggataacacctcgctcgctgagcatctcagtgaaaccaacttctattta
ggtaagtactacctaagtctgggggatttggacagcgccacggcactgttcaaactggcg
gttgccaacaacgttcataactttgttgagcaccgatacgcattgttggaattatcgctc
ctgggccaggaccaagatgacctggcagaatcggaccagcaatag
              
                            

Download fasta file
RegulonDB