RegulonDB RegulonDB 10.9: Gene Sequence
yfeH gene sequence


Size: 999        A: 188  T: 294  G: 278  C: 239

Fasta

 

>yfeH E. coli K12. Version NC_000913.3 GI:556503834
atgaaactttttcgtatcctcgatcctttcaccttaaccctgatcacggtggtgttgctg
gcctctttctttccggccagaggcgatttcgtccccttctttgaaaatctgaccaccgca
gctattgccctgctgttctttatgcacggcgcgaagttgtcgcgtgaggcgattattgct
ggcggtggtcactggcgactgcatttgtgggtaatgtgcagcaccttcgtgctgtttccg
attctgggtgtactgtttgcctggtggaaaccggtaaatgtcgacccgatgctctactcc
ggttttctctacttgtgcattctcccggctaccgtgcagtctgcaatcgccttcacgtca
atggcgggcggtaacgtcgcggcagcggtttgttctgcgtcggcatccagcctgctgggg
attttcctttcaccattgctggttggtctggtgatgaatgttcacggtgcagggggcagc
cttgagcaggtcggtaaaattatgctgcaactgctgctgccgtttgtgttggggcatctt
tcccggccgtggattggtgactgggtgtcgcgcaataaaaaatggattgcgaaaactgac
cagacgtccattctgttggtggtttatacagcgttcagcgaagccgtcgttaatggtatc
tggcataaagttggctggggatcattgctgtttatcgtggtggtcagctgcgttcttctg
gctatcgtgattgtagttaacgtctttatggcacgccgactgagcttcaataaggcagat
gaaattactatcgtcttttgtggttcgaaaaagagtctggcaaatggcatcccgatggca
aacattctgttccccacatcggtgatcggtatgatggtgctgcccctgatgattttccat
cagatccaattgatggtctgtgcggtgctggcgcgtcgatacaaacgccagaccgaacag
ttacaggcgcagcaggaaagcagcgccgataaagcttaa
              
                            

Download fasta file
RegulonDB