RegulonDB RegulonDB 10.8: Gene Sequence
glaR gene sequence


Size: 663        A: 145  T: 163  G: 208  C: 147

Fasta

 

>glaR E. coli K12. Version NC_000913.3 GI:556503834
atgaccattacgtctctggatggctatcgctggctgaagaacgatattattcgcggtaat
tttcaaccggatgaaaaattacgaatgagtttgctgacatcgcgttatgcacttggcgtt
gggccgttacgggaagctctttcgcaactggtggcggaacggctggtcacggtggtgaat
caaaaagggtatcgggtggcgtctatgtcagagcaggagctgctcgatattttcgacgcc
cgcgccaatatggaagcgatgttagtgagtctggcgattgcccgcggtggcgatgagtgg
gaggcagacgttctcgcaaaagcgcatctgctgagtaagcttgaggcctgtgacgccagc
gagaaaatgcttgatgagtgggatctgcgtcatcaggcgtttcatacggcaattgtggcg
ggctgtggttctcactatttgctgcaaatgcgtgaacggttgtttgatctggcggcgcgt
tatcgatttatctggctgcggcgaacggtgctttcggtggaaatgctggaggataaacac
gatcagcaccagaccctgactgcggcggtactggcgcgagataccgcgcgcgccagtgag
ttaatgcgccagcatttactgacgccaattcccattatccagcaggcgatggctggcaat
taa
              
                            

Download fasta file
RegulonDB