RegulonDB RegulonDB 10.8: Gene Sequence
lhgD gene sequence


Size: 1269        A: 275  T: 262  G: 366  C: 366

Fasta

 

>lhgD E. coli K12. Version NC_000913.3 GI:556503834
atgtatgattttgtgattattggcggcggcatcatcggcatgtcgaccgccatgcaactg
attgatgtctatccggacgcccgcattgcgttgctggaaaaagagtccgccccggcctgt
caccagacgggccacaacagcggcgtgatccatgccggggtctattacacgcccggcagc
ctgaaggcgcagttttgcctggcgggaaaccgcgccaccaaagccttttgcgatcaaaac
ggcattcgctacgacaactgcggcaagatgctggttgccacgtccgatctcgaaatggaa
cggatgcgcgccttatgggaacgcacagcggcgaacggtatcgagcgcgaatggcttaac
gccgacgaactgcgcgagcgcgaaccgaatatcaccgggctcggcggcatttttgtgccg
tccagcggcattgtcagctaccgcgacgtgacggcggcgatggcaaaaatcttccagtcc
agaggcggtgaaattatctataacgccgaagtcagcgggcttaatgagcataaaaacggc
gtggtgatacgtacccgtcagggcggcgaatatgaagcatcaacgctgattagctgttcc
gggctgatggctgaccggctggtgaaaatgctcggactcgaaccgggctttatcatctgc
ccgttccgtggcgagtatttccgccttgcgccggagcataaccagattgttaaccacctg
atttaccccattcccgacccggcaatgccgtttttgggcgttcatctcacccgcatgatc
gacggcagcgtgaccgtcgggccaaacgcggtgctggctttcaaacgcgaaggctatcgc
aagcgcgacttctcatttagcgacacgctggagattttgggctcgtcggggattcgccgg
gtgctgcaaaaccatctacgctcaggactgggcgagatgaaaaactcgctgtgcaaaagc
ggctatctgcggctggtgcaaaagtattgtccccggctttcgttaagcgatctccagccc
tggcccgccggtgtgcgggcgcaggcggtatcgccggacggcaagctgattgacgatttt
ctgtttgtcaccaccccgcgcacgatccacacctgcaatgcgccctccccggcagcgaca
tcagcaattcctattggtgcgcatattgtcagcaaggtacaaacgctgttggcaagccag
agtaaccccggacgcacgctgcgagcggcacgtagtgtggatgccttacacgccgcattt
aatcaataa
              
                            

Download fasta file
RegulonDB