RegulonDB RegulonDB 10.8: Gene Sequence
dhaM gene sequence


Size: 1419        A: 375  T: 332  G: 363  C: 349

Fasta

 

>dhaM E. coli K12. Version NC_000913.3 GI:556503834
atggtaaacctggtcatagtttcacatagcagccgactgggagaaggtgtcggtgaatta
gcccgtcagatgttaatgagtgatagttgtaaaatcgccattgccgcgggaattgacgat
ccacaaaatcccattggtaccgatgccgtcaaagtgatggaggccatcgaatctgttgct
gatgccgaccatgtgctggtcatgatggatatgggtagcgcattattgagtgctgaaact
gcgctggaattgctggctcccgagatcgccgcaaaagtacgtttgtgtgctgcgccgttg
gtcgaaggtacactggcagcaacggtcagcgcggcctcgggggcggatatcgacaaagtt
atctttgacgccatgcatgcgctggaagccaaacgtgaacaactgggtttaccgtcctcc
gacactgaaatctctgacacatgtcctgcgtacgatgaagaagcccgttctctggcggtg
gtcataaaaaaccgtaacggcctgcatgtacgtccggcctcccggctggtttatacctta
tcgacatttaatgccgatatgttgctggaaaaaaacggcaaatgcgtcacaccagagagt
attaaccagattgcgttactacaagttcgctataacgatacgctgcgcctgattgcgaaa
gggccagaagctgaagaggcactgatcgctttccgtcagctggctgaagataactttggt
gaaacggaggaagtcgctccacctactctgcgtcccgttccgcctgtttcgggtaaagcc
ttttattatcaaccagttttatgtacggtacaggcaaaatcaaccctgaccgtggaagaa
gaacaagatcgattacgccaggctattgacttcacgttattagatctgatgacgttaaca
gcgaaagcagaagccagcgggcttgacgatattgccgcaatcttttctggtcaccataca
ctgttagatgatccggaactgctggcggcggcaagcgaactccttcagcatgaacattgc
acggcagaatatgcctggcagcaagttcttaaagaacttagccagcaataccagcaactg
gatgatgaatatctacaagctcgctatattgatgtggacgatcttctgcatcgcaccctg
gtccacctgacccaaacgaaagaagaactcccgcagtttaactcgccaactattctactg
gcggagaacatttatccttccacagtactgcaactggatccggcggttgtaaaaggtatc
tgccttagcgccggaagtccggtatcccacagcgccctaatcgcccgtgaactggggatt
ggctggatttgccagcagggtgagaaactgtatgcgatacaaccagaagaaacgctaacg
ctggacgttaaaacgcaacgtttcaaccgtcagggttaa
              
                            

Download fasta file
RegulonDB