RegulonDB RegulonDB 10.8: Gene Sequence
ychN gene sequence


Size: 354        A: 88  T: 83  G: 101  C: 82

Fasta

 

>ychN E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaaaatcgtgatcgttgccaatggcgcaccttacgggagcgaatccttgtttaac
agcttgcggctggccattgcgttacgagagcaggagagcaatctggatctgcgtctgttc
ctcatgtctgatgcggtcacagccgggttgcgcgggcaaaaaccaggggaaggctacaac
attcagcaaatgctggagatccttaccgctcagaatgtaccggtgaaattgtgcaaaacc
tgtaccgacgggcgcgggattagtacacttcctctgattgatggggtggaaatcggtact
cttgtggaactggcgcaatggacgctgtcagccgataaagtgctcacattttaa
              
                            

Download fasta file
RegulonDB