RegulonDB RegulonDB 10.8: Gene Sequence
rfbD gene sequence


Size: 900        A: 255  T: 226  G: 217  C: 202

Fasta

 

>rfbD E. coli K12. Version NC_000913.3 GI:556503834
atgaatatcctcctttttggcaaaacagggcaggtaggttgggaactacagcgtgctctg
gcacctttgggtaatttgattgcttttgatgttcactctactgattattgcggtgatttt
agtaatcctgaaggtgtagctgaaaccgtaagaagcattcggccggatattattgtcaat
gcagccgctcacaccgcagtagacaaagcagaatcagaaccggagtttgcacaattaatt
aacgcaacaagtgtcgaagcgattgcgaaagcagcaaatgaagttggagcctgggttatc
cattactcgactgattacgtcttccctggaaatggcgatatgccatggctggagacggat
gcaaccgcaccactaaatgtttacggtgaaaccaagttagccggagaaaaagcgttacag
gaatattgcgcgaagcatcttattttccggaccagctgggtctatgcaggaaaaggaaat
aacttcgccaaaacgatgttacgtctggcaaaagagcgtgaagaattagcggttattaac
gatcagtttggtgcgccaacaggtgctgaactgctggctgattgtacagcacatgccatt
cgtgtcgcactgaataaaccggatgtcgcaggcttgtaccatttggtagccagtggtacc
acaacctggtacgattatgctgcgctggtttttgaagaggcgcgcaaagcaggcattccc
cttgcactcaacaagctcaacgcagtaccaacaacagcctatcctacaccagctcgtcgt
ccacataactctcgccttaatacagaaaaatttcagcagaactttgcgcttgtcttgcct
gactggcaggttggcgtgaaacgaatgctcaatgaattatttacgactacagcaatttaa
              
                            

Download fasta file
RegulonDB