RegulonDB RegulonDB 10.8: Gene Sequence
gatD gene sequence


Size: 1041        A: 250  T: 283  G: 290  C: 218

Fasta

 

>gatD E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcagtggtgaatgatactgatggtatcgtgcgcgttgcagaaagcgtcattcct
gaaattaaacatcaggatgaggtgcgggtaaaaattgccagctcgggcttatgtggttcc
gatttacccaggatatttaaaaatggtgcacattattatccaataacgttaggccatgaa
tttagcggctatattgatgcggtgggatccggtgttgatgatttacaccctggcgatgcg
gttgcctgtgtgccgttattaccctgttttacttgtccagagtgtctgaaagggttttat
tcccagtgcgcaaaatatgattttattggctcgcggcgtgatggtggatttgctgaatat
attgtcgttaagcgaaaaaatgtctttgctctacccacggatatgcctattgaggatggg
gcttttattgagccgattaccgttggtctgcatgcttttcatttagcgcaaggttgtgag
aataaaaacgttattattattggtgccggaaccattggcctgctggccattcagtgcgct
gtcgcgctgggagcaaagagtgtgacggcgatcgacattagttcagaaaaactggcactg
gcaaaatctttcggtgcgatgcaaacatttaacagtagcgaaatgagcgcgccgcaaatg
cagagcgttttacgcgaactgcgctttaatcagcttatcctcgagacggctggcgtaccg
caaactgtcgaactggcggtagagattgccggtcctcatgcccaactggcgctggtgggc
acgttgcatcaggatctgcatttaacatcggcaacgtttggcaaaatattgcgtaaagag
ctgacggttatcggcagttggatgaactactccagcccttggccggggcaggagtgggaa
acggcgagccggttgctgacagaacgtaagttaagcctggagccattaatcgctcaccgt
ggaagctttgaaagcttcgcccaggcggtgcgtgacatcgctcgtaatgctatgccgggc
aaagtgttgctcattccctga
              
                            

Download fasta file
RegulonDB