RegulonDB RegulonDB 11.1: Gene Sequence
menE gene sequence


Size: 1356        A: 268  T: 328  G: 431  C: 329

Fasta

 

>menE E. coli K12. Version NC_000913.3 GI:556503834
atgatcttctctgactggccgtggcgtcactggcggcaagtgcggggagaaaccatcgcc
ttacgtcttaatgacgagcaactcaactggcgcgagctttgtgctcgcgtcgatgaatta
gcctccggatttgcggtgcagggggtggttgagggcagcggcgtgatgttgcgggcgtgg
aatacgccgcaaacgctgctcgcctggctggcgttactgcaatgcggggcgcgggtgttg
cccgtgaaccctcagctgccgcaaccgttgcttgaagaattgctgcccaatctgacgctg
caatttgctctggtgccggatggggaaaacacgtttccggcattaacgtcgctgcacatt
cagctggttgaaggcgcacatgccgctacgtggcagccgacgcgtctgtgctcaatgacg
ttgacctcgggttctaccggtttgccgaaagccgctgtccatacttatcaggcccatctt
gccagtgcgcaaggtgtgttatcgctgattccgtttggcgatcacgatgattggttgctc
tctttaccgctgtttcacgtctccggtcagggaattatgtggcgctggttatacgctggt
gcgcggatgacggtacgtgataaacagccattggagcaaatgctggcaggctgtactcac
gcttcactggtgccaacacaactctggcgtttgctggttaaccgtagttccgtttccctg
aaagcggtgttacttggcggcgcggctatcccggtcgagttgacggaacaggcgcgcgag
caggggattcgttgcttttgcggctatggtctgaccgagtttgcctccacggtgtgtgcg
aaagaagccgacggcctggcagacgttggttcgccgctgccgggtcgggaagtgaaaatc
gttaataatgaagtgtggctgcgggctgccagtatggcagaaggttactggcgtaacggg
caactggtttcactggttaatgacgaaggctggtacgctacgcgcgatcgcggtgagatg
cataatggcaagctgaccattgtcggacgtttagacaatctattcttcagtggcggagag
ggtattcagccggaagaagtcgagcgcgtaattgctgcacatcctgcggttttgcaggtg
tttatcgtccccgttgccgacaaggagtttggtcatcgaccggtggcggtgatggagtat
gaccacgagagcgttgatcttagtgaatgggtgaaagataagctggcccgttttcaacaa
ccggtgcgctggctaactctgccgccggagctgaaaaacggcggtattaaaatttcacgt
caggcgctaaaagagtgggtgcaacgtcagcaataa
              
                            

Download fasta file
RegulonDB