RegulonDB RegulonDB 11.1: Gene Sequence
garD gene sequence


Size: 1572        A: 394  T: 347  G: 453  C: 378

Fasta

 

>garD E. coli K12. Version NC_000913.3 GI:556503834
atggccaacatcgaaatcagacaagaaacgccaactgcgttttatataaaagttcacgac
acagataatgtggcaattattgttaatgataatggcctgaaagcaggaacgcgttttccg
gatgggctggaattaattgaacatattccccaggggcataaagtcgcattgctggacatt
ccggctaatggtgaaattattcgttatggcgaagtgattggttacgccgtgcgtgcaatc
ccacgcggaagctggatcgacgaatcaatggttgtactaccggaagcgccgccgttacac
acgctgccactggcaaccaaagtcccggaacccttaccgccgctggaaggatacaccttt
gagggctatcgcaatgccgatggcagcgtgggcaccaaaaacctgctcggtatcaccacc
agcgtccactgtgtggcaggcgtggtggactatgtagtaaaaatcattgaacgcgatctg
ctaccgaaatacccgaacgtcgatggcgtggtggggctgaatcatttgtacggttgtggc
gtggcgattaacgcaccggcggcagttgtacctatccgtaccattcacaatatttcgctg
aatcctaactttggcggcgaagtaatggtgattggcctgggttgtgaaaagttgcagcct
gagcgcctgctgactggaacggatgatgtgcaagctattccagtagaaagcgccagcatt
gtcagtttgcaggatgaaaagcatgtcggttttcagtccatggtcgaggatattttgcag
atcgccgaacgccatctacaaaaactgaatcaacggcagcgagaaacctgcccggcttca
gaactggtcgttggtatgcagtgcggtggcagcgatgcgttttctggtgtaacggcaaac
ccggcggttggctatgcgtctgatctactggtgcgctgcggcgcaacggtgatgttttca
gaagtaacggaagtgcgtgacgcgatccatctgctgacaccacgcgcagtgaacgaagag
gtcggcaaacggctgctggaggagatggagtggtacgataactatctcaatatgggaaaa
accgaccgcagcgccaacccttcgccgggcaacaagaaaggcggtctggcaaacgtggta
gagaaggcactcggctccattgctaaatcgggtaaaagcgcaattgttgaagtgctgtcg
cccggtcaacgcccgactaaacgcggattaatttacgccgcgacgccagccagcgatttt
gtctgtggcacgcaacaggtggcttcgggtatcacagtgcaagtgtttacgaccggtcgt
ggtacgccgtacggcctgatggcggtacccgtcattaaaatggcaacccgcaccgagctg
gcgaaccgctggtttgatttaatggatattaatgcgggcaccatcgctaccggcgaagaa
actattgaagaggtgggctggaagttgttccactttattctcgacgtcgccagcgggaag
aagaaaaccttctcggatcaatgggggctgcataaccagctggcggtgtttaacccggca
ccggtgacctga
              
                            

Download fasta file
RegulonDB