RegulonDB RegulonDB 10.9: Gene Sequence
yjhF gene sequence


Size: 1350        A: 270  T: 418  G: 341  C: 321

Fasta

 

>yjhF E. coli K12. Version NC_000913.3 GI:556503834
atgccactaattatcgttgtggcagggattgctttactcctgcttttaaccataaaaatt
aagcttaatacgtttgtttcgttaattattgtctcgattgctgtcgccatcgccagtggt
atggatttgagtaaagtcgtcacctcagtcgaatccggacttggcggtacgctgggccat
attggtttgatatttggcttcggtgttatgctcggtcgcttgctggccgatgcgggtggt
gcgcagcgaatagcgctgaccatgctgaattatttcgggaaaaataaacttgactgggca
gtggtctgttcggcgtttattgtcggtatcgcactttttttcgaagtcggtttaattctt
ctggtacctattttattcgctattgcccgtgaagcaaaaatatcaccgatgtttatgtgt
gtgccgatgctttctggtttgctggtcgcacacggttttttgccgccgcaccccggcccg
actgttatcgccagggaatatggcgctgatgtaggattggtactgatatacggtatcatt
gtcggcattccaacctttattctttgcggcccggtattgaataaattctgccagcgcatt
attccggacgcctttaaaaaagaggggaatatagcctctctcggcgcgacccgccgattc
agcgaaagcgaaatgccaggctttgggatcagttttctcacggcaatgctgccggtgatc
ctgatggcggttgtcaccatcatccagatgactcatgccaaaagtgccgcggattcaggc
ttattttacaacgtgatactgttcttaggtaattcaacgatcgccatgctgatttcactg
ctattcgcgatctataccatgggcctggggcgcgggaaaacaatccctgacctgatggat
tcttgcggaaaagctatcgcgggtattgccggtctgctgctgattatcggtggtggtggt
gcattcaagcaagttctcatcgactctggcgttggtcagtatatttccaccctggtttcg
ggtatggatattaacccgatcctgatggcctggggcgtggccgcattcctgcgtatttgt
ctgggttcagccaccgtcgcggcgatctctaccgccggtctggtcatcccattgttggca
gtacatcccaataccaacctggccttgattacgctggctaccggtgccggatcctgtatt
tgttctcacgttaacgatgccagtttctggatgattaaagacttttttggcctgaccacc
aaagaaacgctgttatcctggacgctgatgtccacactcttatccatcagtgggctgatt
tttattctgctcgccagcttagttttataa
              
                            

Download fasta file
RegulonDB