RegulonDB RegulonDB 10.9: Gene Sequence
torR gene sequence


Size: 693        A: 159  T: 171  G: 196  C: 167

Fasta

 

>torR E. coli K12. Version NC_000913.3 GI:556503834
atgccacatcacattgttattgttgaagatgagccggttacccaggcgcgattacaatcc
tacttcactcaggaggggtataccgtttccgttacggcgagcggtgctgggctacgggaa
attatgcagaatcagtcggtagatttaattctgctggatatcaacttacccgatgaaaat
ggcctgatgttaacccgcgccctgcgagaacgctcaacggtggggattattctggttacc
ggacgcagcgatcggattgaccgtattgttgggctggaaatgggcgcagacgattacgtc
accaaaccgctggaactgcgcgaactggtagtacgggtgaaaaatctgctctggcgaatc
gacctcgcgcgacaagctcaaccgcacactcaggacaactgctatcgctttgccggttat
tgcctgaatgtgtcgcgccatacgctggagcgggatggcgagccgattaaactgacccgc
gcagagtatgaaatgttggtggcatttgtgacgaatccgggcgaaattctcagccgtgaa
cgtctgctacgtatgctttctgcgcgtcgggtggaaaaccctgacctgcgcaccgtcgat
gtgttaattcgtcgtttacgtcataaactcagcgcggatttactggtgacgcaacatggt
gaaggttatttcttagccgctgatgtgtgctga
              
                            

Download fasta file
RegulonDB