RegulonDB RegulonDB 10.9: Gene Sequence
dppB gene sequence


Size: 1020        A: 179  T: 265  G: 304  C: 272

Fasta

 

>dppB E. coli K12. Version NC_000913.3 GI:556503834
atgttgcagtttattctccgacgtttgggactcgtcatccccacgtttatcggtattacc
cttctcacatttgcctttgtccacatgatcccgggcgatccggtgatgatcatggcgggc
gaacgtgggatctccccagagcgtcacgcgcagctgctggctgaactcggcttagataaa
ccgatgtggcagcagtatctccattacatttggggcgttatgcatggcgatctaggcatt
tcaatgaaaagccgcatcccggtttgggaagagttcgtgccgcgcttccaggccacgctg
gaacttggcgtctgcgcgatgatttttgctacggcagtcggtattccggtcggcgtgctg
gctgcggttaaacgcggttccattttcgatcacacagcggttggcctggcgctgacaggt
tattcaatgcctatcttctggtggggcatgatgctgatcatgctggtttcggtgcactgg
aacctgacgcccgtctccggtcgcgtgagcgatatggtgttcctcgatgactccaatccg
ttaaccggttttatgctaatcgacaccgccatctggggtgaagacggcaactttatcgat
gccgtcgcccatatgatcttgcctgccattgtgctgggtactattccgctggcggtcatt
gtgcgtatgacacgctcctcgatgctggaagtgctgggcgaggattacatccgcaccgcg
cgcgccaaagggctaacccgcatgcgggtgattatcgtccatgcgctgcgtaacgcgatg
ctgccggtggtgaccgttatcggcctgcaggtgggaacattgctggcgggggcgattctg
accgaaaccatcttctcgtggcccggtctgggacgctggttgattgacgcactgcaacgc
cgcgactatccggtagtgcagggcggcgtattgctggtggcgacgatgattatcctcgtc
aacttgctggtcgatctgctgtacggcgtggtgaacccgcgtattcgtcataagaagtaa
              
                            

Download fasta file
RegulonDB