RegulonDB RegulonDB 10.9: Gene Sequence
dppC gene sequence


Size: 903        A: 142  T: 228  G: 278  C: 255

Fasta

 

>dppC E. coli K12. Version NC_000913.3 GI:556503834
atgtcacaggttactgaaaataaagtgattagcgcaccggtgccgatgaccccgttacag
gagttctggcactattttaaacgcaacaaaggcgcggtcgtcgggctggtttacgtcgtc
atcgtgctgttcatcgcgatctttgccaactggattgcaccctataacccggcggaacag
ttccgcgatgcactgctcgccccgccagcctggcaggaaggcggcagcatggcgcacttg
ctgggcaccgatgacgtaggccgtgatgtgctgtcgcgcctgatgtacggtgcgcgcctg
tcgctgctggttggctgtctggtagttgtgttatcgctgattatgggcgttattctcggc
ctgatcgccggttactttggcggcctggtcgataacatcattatgcgcgtggtcgatatc
atgctggcgctgccaagtctgctgctggcgctggtgctggtggcaattttcggcccgtcg
attggtaacgccgcgctggcactgaccttcgttgccttgccgcactatgtgcgcttaacc
cgcgccgccgtgctggtggaagttaaccgcgattacgtcaccgcgtctcgcgtggcgggt
gccggggcgatgcgtcagatgtttattaacatcttcccgaactgccttgcgccgctgatt
gttcaggcgtcgctcggtttctctaacgccattctcgatatggctgctcttggtttcctc
ggcatgggggcacagccgccaacgcctgagtggggcaccatgctctccgacgtgttgcag
ttcgcgcaaagcgcctggtgggtcgtgaccttcccgggtctggcgatcctgctgacggtg
ctggcatttaacctgatgggtgacggtctgcgtgacgcgctcgatcccaaactgaagcag
taa
              
                            

Download fasta file
RegulonDB