RegulonDB RegulonDB 10.10: Gene Sequence
dppF gene sequence


Size: 1005        A: 230  T: 211  G: 290  C: 274

Fasta

 

>dppF E. coli K12. Version NC_000913.3 GI:556503834
atgagtacgcaagaggccaccctgcaacaaccgctgttgcaggctatcgacctgaaaaaa
cattatccggtgaagaaaggcatgttcgcgccggaacgtctggttaaagcgctggatggc
gtttcgtttaaccttgaacgtggcaaaacgctggcagtagtgggcgaatctggctgcggt
aaatcgaccctcggtcggttgctgacgatgattgaaatgcccaccggtggcgagctgtat
taccaggggcaggatctgcttaagcacgatccgcaggcgcagaagctgcgtcggcagaaa
atccagatcgtcttccagaacccttacggttcgctgaatccgcgtaaaaaagtcgggcaa
attcttgaagagccgctgctgatcaacaccagcttaagcaaagaacagcgtcgggaaaaa
gccctgtcgatgatggcgaaagtcggcctgaaaaccgagcactatgaccgctatccgcat
atgttctccggcggtcagcgtcagcgtatcgccatcgcccgtggtctgatgctcgacccg
gatgtggtgattgccgatgaaccggtttccgcgctggatgtttcagtgcgcgcgcaggtg
ctgaatctgatgatggatttgcagcaggagttggggctgtcttatgtctttatctcccac
gacctgtcggtggtggagcacattgctgatgaagtgatggtgatgtacctgggccgctgc
gtggagaagggaacgaaagaccaaatcttcaataacccgcgccatccgtacactcaggcg
ctactttccgcgacgccgcgcctgaacccggacgatcgccgcgagcgcatcaagctcagc
ggtgaactaccaagcccactgaatccaccgccgggttgcgccttcaacgcccgctgtcgt
cggcgcttcggcccctgcacccagttgcagccgcagctaaaagactacggcggtcaactg
gtagcttgttttgctgttgatcaggatgaaaatccgcagcgttaa
              
                            

Download fasta file
RegulonDB