RegulonDB RegulonDB 10.8: Gene Sequence
lpxH gene sequence


Size: 723        A: 156  T: 173  G: 205  C: 189

Fasta

 

>lpxH E. coli K12. Version NC_000913.3 GI:556503834
gtggcgacactctttattgcagatcttcatctctgcgtggaagaaccggcgatcaccgcc
ggttttctgcgttttttagcgggggaagcccgcaaggccgacgcgctgtatattcttggc
gatctgtttgaagcatggattggcgacgacgatcccaacccactccatcgcaagatggcg
gcggcgatcaaagcggtgtccgattccggcgttccctgttatttcattcatggcaaccgt
gattttctgctcggcaaacgctttgcccgtgaaagtggcatgacgttattgccggaagaa
aaggtgctcgaactttatggtcgccgggtgttgattatgcatggcgacacgctgtgcacc
gatgacgcgggttatcaggcttttcgcgccaaggtccacaaaccctggctgcagacgcta
ttcctcgccctgccgttgtttgtgcgcaaacgcattgccgcgcgaatgcgcgcgaacagc
aaagaagccaacagcagtaaatcgctggcgatcatggacgttaaccaaaacgcggtggtc
agtgcgatggaaaaacatcaggtgcaatggctgatccacgggcatacccatcgcccggcg
gtgcatgaacttatcgccaatcagcaacctgcttttcgcgtggtactgggtgcctggcat
acggaaggttcaatggtgaaagtcacggcggatgacgttgagctgattcattttccgttt
taa
              
                            

Download fasta file
RegulonDB