RegulonDB RegulonDB 10.8: Gene Sequence
rarA gene sequence


Size: 1344        A: 315  T: 309  G: 376  C: 344

Fasta

 

>rarA E. coli K12. Version NC_000913.3 GI:556503834
gtgagcaatctgtcgctcgatttttcggataatacttttcaacctctggccgcgcgtatg
cggccagaaaatttagcacagtatatcggccagcaacatttgctggctgcggggaagccg
ttgccgcgcgctatcgaagccgggcatttacattctatgatcctctgggggccgccgggt
accggcaaaacaactctcgctgaagtgattgcccgctatgcgaacgctgatgtggaacgt
atttctgccgtcacctctggcgtgaaagagattcgcgaggcgatcgagcgcgcccggcaa
aaccgcaatgcaggtcgccgcactattctttttgttgacgaagttcaccgtttcaacaaa
agccagcaggatgcatttctgccacatattgaagacggcaccatcacttttattggcgca
accactgaaaacccgtcgtttgagcttaattcggcactgctttcccgtgcccgtgtctat
ctgttgaaatccctgagtacagaggatattgagcaagtactaactcaggcgatggaagac
aaaacccgtggctatggtggtcaggatattgttctgccagatgaaacacgacgcgccatt
gctgaactggtgaatggcgacgcgcgccgggcgttaaatacgctggaaatgatggcggat
atggccgaagtcgatgatagcggtaagcgggtcctgaagcctgaattactgaccgaaatc
gccggtgaacgtagcgcccgctttgataacaaaggcgatcgcttttacgatctgatttcc
gcactgcataagtcggtacgtggtagcgcacccgatgcggcgctgtactggtatgcgcga
attattaccgctggtggcgatccgttatatgtcgcgcgtcgctgtctggcgattgcgtct
gaagacgtcggtaatgccgatccacgggcgatgcaggtggcaattgcggcctgggattgc
tttactcgcgttggcccggcggaaggtgaacgcgccattgctcaggcgattgtttacctg
gcctgcgcgccaaaaagcaacgctgtctacactgcgtttaaagccgcgctggccgatgct
cgcgaacgcccggattatgacgtgccggttcatttgcgtaatgcgccgacgaaattaatg
aaggaaatgggctacgggcaggaatatcgttacgctcatgatgaagcaaacgcttatgct
gccggtgaggtttacttcccgccggaaatagcacaaacacgctattatttcccgacaaac
aggggccttgaaggcaagattggcgaaaagctcgcctggctggctgaacaggatcaaaat
agccccataaaacgctaccgttaa
              
                            

Download fasta file
RegulonDB