RegulonDB RegulonDB 10.8: Gene Sequence
ycaK gene sequence


Size: 591        A: 169  T: 169  G: 152  C: 101

Fasta

 

>ycaK E. coli K12. Version NC_000913.3 GI:556503834
atgcagtctgaacgtatttatttggtatgggcccatcctcgtcatgattcattgaccgca
catattgctgatgcgatccatcagcgggcaatggagcggaaaatacaggtgacggaactc
gatttatatcggcgtaatttcaacccagtgatgacgccggaagatgaaccagactggaag
aatatggataaacgttattctccagaggttcatcagctttattcagagctgcttgaacat
gacacgttagtggtggtttttcctctctggtggtacagcttcccggcaatgctaaaagga
tatattgacagagtatggaataatgggctggcttatggagatgggcacaaattaccattc
aataaagttcgttgggtggcgctggttggaggagacaaagaatcatttgtccagatgggc
tgggaaaaaaatataagcgattatttaaaaaatatgtgcagttatcttggtattgaagat
gccgatgtcactttcttgtgtaatacagtggtattcgatggggaagaacttcacgcgagc
tattatcagtcgttattatctcaggtacgggatatggtagatgcactataa
              
                            

Download fasta file
RegulonDB