RegulonDB RegulonDB 10.10: Gene Sequence
yccJ gene sequence


Size: 228        A: 73  T: 48  G: 62  C: 45

Fasta

 

>yccJ E. coli K12. Version NC_000913.3 GI:556503834
atgccaactcaagaagcgaaagctcatcacgtcggtgaatgggcatctctgcgcaatacg
tcgccggaaatagccgaggccattttcgaagtcgccgggtacgacgaaaaaatggcggaa
aagatttgggaagaaggtagtgatgaagtgttagtcaaagcctttgctaagaccgataaa
gattcgcttttttggggcgaacagaccatcgaacgtaaaaacgtttaa
              
                            

Download fasta file
RegulonDB