RegulonDB RegulonDB 10.10: Gene Sequence
uxaA gene sequence


Size: 1488        A: 364  T: 325  G: 426  C: 373

Fasta

 

>uxaA E. coli K12. Version NC_000913.3 GI:556503834
atgcaatacatcaagatccatgcgctggataacgtcgcggtcgctttagcagatttggct
gaaggcacagaagtcagtgtcgataaccagactgttacgctgcgccaggatgttgctcgt
ggacataaatttgcgttaacggatatcgcaaaaggggccaatgtcatcaaatatggcctg
ccgattggttatgcattggcggatattgcggcaggtgttcacgttcacgcccacaatacg
cgcacgaatctgagcgatctggatcagtatcgctatcaacctgattttcaggatctgcct
gcgcaagcggcagatcgtgaagtgcagatctatcgtcgcgctaacggcgatgtcggggtg
cgtaatgagctgtggatcctgccaaccgtgggctgtgtcaacggcatcgcgcggcagatc
cagaaccgttttctgaaagagaccaacaacgccgaaggtactgacggcgtgttcctcttc
agccacacctacggctgctcacagctgggcgacgatcacattaatacccgcaccatgctg
caaaacatggtgcgccacccgaacgcaggcgcagtgctggtgattggtctgggctgtgaa
aacaaccaggttgccgcattccgtgaaacgctgggcgatatcgatcctgaacgcgttcat
ttcatgatctgccaacagcaggatgatgagatcgaagccggaatcgagcatttgcatcag
ctgtataacgtgatgcgcaacgataaacgcgagccaggcaaactcagcgaactgaagttt
ggtctggagtgcggtggttctgacggtctttctggtattactgctaacccgatgctgggg
cgtttctctgactacgtgattgctaacggcggtactaccgtactgaccgaagtgccggag
atgtttggcgcagagcagttgctgatggaccattgccgcgacgaagcaacgtttgaaaaa
ctggtcaccatggtcaacgacttcaaacagtactttattgcccatgatcagccgatctat
gaaaacccatcgccggggaacaaagcgggcggtatcaccacgctggaagacaaatcactt
ggctgtacccagaaagcgggttccagcgtcgtggttgacgtgctgcgttacggcgagcgt
ctgaaaacgccagggctgaacttgttaagtgcgccgggtaacgatgccgtagcgaccagc
gccctggcgggtgcgggctgccatatggtgctgttcagtactggtcgtggcacgccgtat
ggtggatttgtgccgacggtgaaaatcgccaccaacagtgaactggcggcgaagaaaaaa
cactggatcgactttgacgcgggtcagttgatccacggtaaagcgatgccgcagttgctg
gaagaatttatcgacaccatcgttgagtttgccaacggtaagcaaacctgtaacgagcgt
aacgacttccgcgaactggcgatcttcaaaagcggcgtaacgctataa
              
                            

Download fasta file
RegulonDB