RegulonDB RegulonDB 10.9: Gene Sequence
exuT gene sequence


Size: 1299        A: 251  T: 341  G: 389  C: 318

Fasta

 

>exuT E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaaaattaaagggttacgttggtatatgatcgcactggtgacgctcggcaccgtg
cttggttacctgacgcgtaacactgtggcggcagctgcgccaactctgatggaagagtta
aacatctccacccaacagtattcctatatcatcgcagcctattctgctgcttatacggtc
atgcaaccggtagcaggttatgtactggatgtgctgggtacgaaaatcggttatgcaatg
tttgctgtgctgtgggccgtgttctgtggtgcaaccgcgctggcaggtagctggggtggc
ctggctgttgctcgtggtgcggtcggtgccgcggaagcagcgatgatcccggcgggtctg
aaagccagctccgaatggttcccggcgaaagagcgttccatcgcagtaggctactttaac
gtaggttcttcgattggtgcgatgattgcgccgccgctggtggtatgggcaatcgtaatg
cacagctggcagatggcatttatcatctccggtgcattgagctttatctgggcgatggca
tggctgattttctataaacatccgcgcgaccagaagcatctgaccgatgaagaacgcgac
tatattattaatggtcaggaagcccagcaccaggtgagcacggcgaagaaaatgtccgtt
ggtcagatcctgcgtaaccgtcagttctggggtatcgcgctgccgcgtttcctggcagaa
ccggcctggggtacttttaacgcgtggatcccgctgttcatgtttaaagtttacggcttt
aacctgaaagagatcgcgatgttcgcctggatgccgatgctgtttgctgacctcggttgt
atcctcggtggttacctgccgccgctgttccagcgttggtttggtgtgaacctgatcgtt
tcccgtaagatggtcgtaacgctgggtgcagtgctgatgattggcccgggtatgatcggc
ctgttcaccaacccgtatgtcgcaattatgctgctgtgtatcggtggttttgcccaccag
gcactgtctggcgcgctgattacgctctcttccgatgtgtttggtcgtaacgaagtggca
acggcaaacggtttaaccgggatgtccgcatggctggcaagtacgctgtttgcgctggtt
gtcggtgcactggctgacaccatcggcttcagcccgctgttcgcagttctggcagtgttc
gacctgttaggtgcgctggttatctggaccgtgttgcagaacaaaccggcgattgaggtg
gcgcaggaaacacataacgatcccgcaccgcaacattaa
              
                            

Download fasta file
RegulonDB