RegulonDB RegulonDB 10.9: Gene Sequence
yhbY gene sequence


Size: 294        A: 90  T: 61  G: 72  C: 71

Fasta

 

>yhbY E. coli K12. Version NC_000913.3 GI:556503834
atgaatctgagtactaaacaaaaacagcacctgaaaggtctggcacatccgctcaagcca
gttgttctgcttggcagtaatggtttgaccgaaggggtgctggccgagattgaacaagcg
ttagagcaccatgaactcatcaaggtgaaaatcgccaccgaagatcgcgaaactaaaacc
ttgatcgtggaagctatcgtgcgcgaaaccggcgcctgtaatgtacaggtcatcggtaaa
acgctggtgctttatcgcccaactaaagaacgtaaaatctcgctgccacgctaa
              
                            

Download fasta file
RegulonDB