RegulonDB RegulonDB 11.1: Gene Sequence
yhdZ gene sequence


Size: 759        A: 204  T: 198  G: 206  C: 151

Fasta

 

>yhdZ E. coli K12. Version NC_000913.3 GI:556503834
atgagccaaattttactgcaacctgctaacgcgatgattacgctggaaaacgtcaataaa
tggtatggacaattccatgttttgaaaaatataaatttaaccgtgcaaccgggagaacgg
atcgttctgtgtggcccttcaggttccggtaaatcgacaaccattcgttgtattaatcat
ctggaagaacatcaacagggacggatcgtggtagatggcatcgaacttaatgaagatatc
cgcaatattgagcgcgtcaggcaggaagtgggaatggtctttcagcatttcaatctcttc
cctcatctgaccgttttacagaactgtaccctggcaccgatttgggtacgcaagatgcct
aagaaagaggctgaagatctggcggtgcattacctagagcgggtgagaattgccgaacat
gcgcataagtttcccggacagatttcaggtggtcagcagcaacgcgttgccattgcgcgt
tcgctgtgtatgaagccgaaaattatgttgtttgatgagccaacgtcggcgctcgatcct
gagatggtgaaagaggtgctggatacgatgattgggctggcgcagtcgggtatgacaatg
ttgtgtgtaacacatgagatggggtttgcacgaaccgtcgctgaccgggtaatttttatg
gatcgtggggaaatagtggagcaagctgcacctgatgaattttttgcgcatcctaaatca
gagcgtacgagggcatttttatcgcaggtaatccattaa
              
                            

Download fasta file
RegulonDB