RegulonDB RegulonDB 10.10: Gene Sequence
ybjC gene sequence


Size: 288        A: 64  T: 79  G: 76  C: 69

Fasta

 

>ybjC E. coli K12. Version NC_000913.3 GI:556503834
atgcgcgcgatcggtaaattgcctaaaggcgtgttgatactggaatttatcggaatgatg
ctactggcggtggcgctgctgtcggtaagcgactccctgtcgctgcctgagccattttct
cggccagaagtgcagattctgatgatttttctcggtgttttgctcatgcttcccgctgcg
gtggtggttattcttcaggtggcaaaacgtcttgccccacagctgatgaaccgtccaccg
caatattcacgttcagaaagagaaaaagataatgacgccaaccattga
              
                            

Download fasta file
RegulonDB