RegulonDB RegulonDB 10.10: Gene Sequence
cas2 gene sequence


Size: 285        A: 73  T: 80  G: 89  C: 43

Fasta

 

>cas2 E. coli K12. Version NC_000913.3 GI:556503834
atgagtatgttggtcgtggtcactgaaaatgtacctccgcgcttacgaggcagattagcc
atctggttgttggaggtacgtgcaggggtatatgtaggtgatgtatccgcaaaaattcgt
gaaatgatctgggaacaaatagctggactggcggaagaaggcaatgtagtgatggcatgg
gcaacgaatacggaaacgggatttgagttccagacatttgggttaaacaggcgtaccccg
gtagatttggatggtttaaggttggtgtcttttttacctgtttga
              
                            

Download fasta file
RegulonDB