RegulonDB RegulonDB 10.9: Gene Sequence
ampH gene sequence


Size: 1158        A: 243  T: 274  G: 334  C: 307

Fasta

 

>ampH E. coli K12. Version NC_000913.3 GI:556503834
ttgaaacgtagtctgcttttttctgccgtgctgtgtgcggcgtcattgacctccgtccat
gcggcgcagccgatcactgaaccggagtttgcctctgatattgtcgatcgttatgccgat
catattttttacggcagcggtgccacggggatggctctggttgttatcgacggtaaccag
cgcgtctttcgcagttatggcgaaacgcgacctggtaataacgttcgcccgcagctggat
tcggtcgtgcgtattgcttccctcaccaagctaatgaccagtgagatgctggtgaaattg
ctcgaccaggggaccgtgaagttaaacgatccgctaagtaaatatgctccgccaggcgca
cgcgtgccaacctacaatgggacgcccattacgctggtcaatctggcaacccataccagc
gccctgccccgtgaacagcccggtggcgcggcacatcgtccggtgtttgtctggccaacg
cgcgagcaacgctggaaatacctttctacggcgaagctgaaagccgcgccaggcagtcag
gcggcgtactctaaccttgcgttcgacctgctggcagatgcactggcgaatgcgtccggc
aagccttatacccagttgtttgaagagcagattacccgtccattggggatgaaagacacc
acctacaccccctcaccggatcagtgccgccgtttaatggttgctgagcgcggtgccagt
ccgtgcaataacacgctggcggcaattggcagcggcggcgtctattccacgcctggcgat
atgatgcgctggatgcagcagtatttgtcatctgatttttatcagcgcagtaaccaggca
gatcgcatgcagacgttgatttatcagcgcgcgcagtttacgaaagtgattggcatggat
gtccccggcaaagcggatgcgcttggtttaggttgggtatatatggccccgaaagagggt
cgtccggggattattcagaagacaggcggtggtggcggtttcattacctatatggcgatg
atcccgcagaagaatattggcgcgtttgtggtggtcactcgttcgccgttgacgcgcttt
aaaaatatgagcgatggcatcaatgacctggtgaccgagctaagcgggaataaaccgttg
gttatccccgcgtcctga
              
                            

Download fasta file
RegulonDB