RegulonDB RegulonDB 10.8: Gene Sequence
yajI gene sequence


Size: 540        A: 156  T: 127  G: 128  C: 129

Fasta

 

>yajI E. coli K12. Version NC_000913.3 GI:556503834
atgaatactaacgtttttcgactgctcctgctgggaagcctgttcagccttagcgcctgt
gtgcagcaaagtgaagtgcgacagatgaaacacagcgtcagcacgctgaaccaggagatg
acgcaactcaatcaagaaacagtcaaaatcactcagcaaaacaggctgaatgcaaaatcc
agcagtggggtttaccttctgcctggagcgaaaacaccggcaagactggaaagccagatc
ggtactttacgtatgtcgctggtgaatattacgcctgatgcagatggcaccacccttaca
ctacgtattcagggtgagtcgaatgatcccttgcccgcattcagcggaactgttgaatat
gggcaaattcagggaacaatagacaactttcaggaaatcaatgtgcagaatcaattgatt
aatgcccctgccagcgtcctcgcccccagcgatgttgatattccgttacagttaaagggg
atttctgtggatcagttaggctttgtacgtatccacgacattcaacctgttatgcagtaa
              
                            

Download fasta file
RegulonDB