RegulonDB RegulonDB 10.10: Gene Sequence
zapA gene sequence


Size: 330        A: 107  T: 69  G: 77  C: 77

Fasta

 

>zapA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgcacaacccgtcgatatccaaatttttggccgttcactgcgtgtgaactgcccg
cctgaccaaagggatgcgttgaatcaggcagcggacgatctgaaccaacggttgcaagat
ctgaaagaacgcactagagtcacaaatactgaacagttggtcttcattgccgcattgaat
atcagctatgagttagcgcaagaaaaagcaaagactcgtgactacgcggcaagtatggaa
cagcgtattcggatgctgcagcagaccatagaacaagcgttacttgaacaaggtcgcatc
accgaaaaaactaaccaaaactttgaatga
              
                            

Download fasta file
RegulonDB