RegulonDB RegulonDB 10.10: Gene Sequence
feoC gene sequence


Size: 237        A: 59  T: 48  G: 72  C: 58

Fasta

 

>feoC E. coli K12. Version NC_000913.3 GI:556503834
atggcttcacttattcaggtgcgcgatttgctggcgttacggggccgtatggaagcggcc
cagataagccagacattgaacactccacagccaatgattaacgccatgctgcaacaactg
gaaagtatgggcaaagccgtgcggattcaggaagaacctgacggctgcctctctggcagt
tgtaaaagctgcccggaaggaaaagcctgtctgcgcgagtggtgggcgctgcgttaa
              
                            

Download fasta file
RegulonDB