RegulonDB RegulonDB 10.8: Gene Sequence
yqcE gene sequence


Size: 1278        A: 283  T: 360  G: 318  C: 317

Fasta

 

>yqcE E. coli K12. Version NC_000913.3 GI:556503834
atgcaacacaactcatatcgccgttggataaccctcgcgataattagttttagcggcggc
gttagtttcgacctggcttatttacgttatatttatcaaattcccatggcgaaatttatg
ggattcagcaataccgagataggtttaataatgagtacctttggtattgcggccattatt
ctttatgcccccagcggcgttattgccgataaattttcacaccgcaaaatgattacttcc
gcgatgatcattaccggattactgggtctgttaatggcaacgtatccaccgctgtgggta
atgctctgtattcagatcgcctttgcgataacgacgattttaatgctgtggtcggtgtcg
attaaagctgcatcgttgcttggcgatcatagcgagcaagggaaaattatgggctggatg
gaagggctgcgcggcgtcggtgtaatgtcgctggcggtgtttaccatgtgggtcttttct
cgctttgcaccggatgacagcaccagcctgaaaacggtcattatcatctatagtgtggtt
tacatcttgttggggattctgtgctggttttttgttagcgataacaacaacctgcgcagt
gccaataacgaagaaaaacagtcattccagcttagcgacatcctggccgttttgcgtatc
agcaccacctggtattgcagcatggtgatttttggcgtcttcaccatctacgccattctg
agttactccaccaactatctgaccgaaatgtatggcatgtcgctggtggcggcgagctac
atggggattgtgatcaacaaaatattccgcgcgctgtgcggcccacttggcggcataatc
accacctacagcaaagtgaaatcccctacccgcgtgatccaaatcctttccgtactcggc
ctgctgacgttaactgccctgctcgtcacgaactctaacccgcaatcggtcgcgatgggg
attggcctgattttactgctgggattcacctgttacgcctcacgcgggctgtactgggcc
tgccctggcgaagcgagaacaccgtcttacattatgggcaccacggtaggtatttgttcg
gtgattggattcctgccggatgtcttcgtttacccaattatcggccactggcaagacacc
ctgcccgctgcagaagcctaccgcaatatgtggctgatgggcatggcggcgcttggcatg
gtgattgtctttacctttttgctgttccaaaaaattcgtactgctgatagcgcccccgca
atggctagcagcaagtaa
              
                            

Download fasta file
RegulonDB